circad | circRNAs associated with diseases

hsa circ 0031288/circPABPN1
Gene	PABPN1	Organism	Human
Genome Locus	chr14:23793346-23793498:+	Build	hg19
Disease	Cervical Carcinoma	ICD-10	Malignant neoplasm of cervix uteri (C53)
DBLink	Link to database	PMID	28080204
Experimental Method
Sample Type	HeLa Cell lines	Comparison	HeLa cells transfected with pcDNA3.0 or pCircPABPN1 (2 μg) or with control siRNAs
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GGACCACCAACTACAACAGC Reverse TTGGGATCACCTGTAGACGC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Abdelmohsen, K, Panda, AC, Munk, R, Grammatikakis, I, Dudekula, DB, De, S, Kim, J, Noh, JH, Kim, KM, Martindale, JL, Gorospe, M (2017). Identification of HuR target circular RNAs uncovers suppression of PABPN1 translation by CircPABPN1. RNA Biol, 14, 3:361-369.